/ Bio Informatics

my first job on tera grid ( running repeatmasker)...

Repeatmasker est.fasta

output

est.fasta.cat
est.fasta.log
est.fasta.masked > gives the output file removing the unwanted and redundant data
est.fasta.out > gives where the changes had been made
est.fasta.tbl

est.fasta.out

SW perc perc perc query position in query matching repeat position in repeat
score div. del. ins. sequence begin end (left) repeat class/family begin end (left) ID

180 25.0 2.1 0.0 seq1165 373 420 (263) + L2b LINE/L2 3234 3282 (93) 1
180 25.0 2.1 0.0 seq1545 549 596 (16) + L2b LINE/L2 3234 3282 (93) 2
180 25.0 2.1 0.0 seq3921 473 520 (48) + L2b LINE/L2 3234 3282 (93) 3
180 25.0 2.1 0.0 seq5025 181 228 (350) + L2b LINE/L2 3234 3282 (93) 4
180 25.0 2.1 0.0 seq5225 149 196 (531) + L2b LINE/L2 3234 3282 (93) 5
180 25.0 2.1 0.0 seq5514 431 478 (123) + L2b LINE/L2 3234 3282 (93) 6
180 25.0 2.1 0.0 seq5573 359 406 (177) + L2b LINE/L2 3234 3282 (93) 7
180 25.0 2.1 0.0 seq7881 289 336 (296) + L2b LINE/L2 3234 3282 (93) 8
180 25.0 2.1 0.0 seq9083 218 265 (302) + L2b LINE/L2 3234 3282 (93) 9

est.fasta.masked

seq1
CAAAGATTAGCTCAACCCCACCCGTGCAGCAGTGGCCAGGAATCCACCAG
TCGCTTTAAATATGCACTACACGCGTTATCGTTGGCGGGGATCCCGGGGG
ATGATCCATTGGCCTTGATACGGGCCACAACCACTGACACGCCCCACAAG
CGAGTTTGGTTCACTGGGGCGAGCTGAAGGTTAGGTCTATCTATTGCGTA
GCCGAAAAAGTCATCACCAGTAACTATGCCGCTCTCCTTGCCCTTTGCCA
TGTGGTAGCTACGTCCTCCTCTATTGCACGTAACCCGGTTCAAAACCACG
AATCGTATCACTTTGCTTCGAAAAACCACTTTGATCCAGATACAAATTAA
ACTGCGATCCGAGCTTACCACCAAATCCGGGAGCATAAGCTGAAAGTGCA
GGAGAGGCAGAGCTGGCGGTGGCCCTTCCACCTCCTTTTATCGTAACACG
ATCGGCACGTCGGGCACTTTCGGGAAGGGCTGCCACACGAAAAGTCTTTT
ATAACTACGAGC
seq2
CCACGCATTATGTAAAAATTACCGACGTGGAGCTTCGTGCCGCCGGATTG
TAAGAATAGCTCGTTGGAGATTACCTGAGTTGGTTGTTCTTTGTGTGTCA
ATCCATCTCGCCCTGACGACGGGGGCAAACATAAAAGTCCGATAACCCCG
AATTCACCTGGAATCATGGACAACCCGGACATTCCTACTTGGAAATCAGA
TCAGAGTTCGCTCGGATCAGCGACTGTTTGCCCGATAACGCGGGACAGGC
ATGGTTTAAAAAGTTCCGTTTTTTGTGCAAATTTCAAGACAATGCGTCTA
ACCGTAGCCTCGAAGGGCTACTTATCGGCTCGCCGGTTATGGGCGGTGAT
TTAAGTTAACGCGTTAGTTTGTAGAGCAGACACGTCCCTGTACCCATCGA
AGAGTTATCTGTGACTATACCCAATATAGTTCACTTAACTACTTATACGT
CCCCTGACAACATATGATCGAAGATAGAACGTTCGGCTATAGGCTATTAG
AGGCGAGTTGTCTCGAGCACACTTATTAATAAATGTCC
seq3
TGCGCACGCGAACGCCCCAGCCTAACGTCGGAAATAAGGGGCCTCTAAAT
CCAAGTGCATTGTTCTCCGCTGGTGCGACACCGGACAAGGGTATGATGGA
GATATGACACTTATACTAACGTATGCGTTCCTAACATTCCACCCCAGGCA
ACGCGTACATGGAGGGCCCCGTTGCCTAAGTTGTATCCCCATGGGTGTGC
CAACCAAAAGACCCAGCGCAAGAGGCACTGCACATTCGAGTTATTGAGGA
CGTAGTTAACCGTAGACCCTTTCCATAAATATGCACCTGAGAAGAATCCT
TATGGTCGGCCACGTTCAGTTCCTCATCGTAAACCGGCAAGACCCTATCG
GGCTACAATTCAGATAACTGCGTAAATTGAATTCTAAGTCTGTTAATCCT
CCTGATAACCGGACGTAGTCAGGTCGCTCAATCTATGCGGGTTGAAGGAC
GCTCTACGGGCCCACCCCACGGAGATTGGGTCCTCGGATCGATCTTGGAT
GTCGATACCAAGAAGTCGGATCAAACACGTCTACTACTGCCGGGGTTTTG
CATCCCTAGCGAGCGGGCGGCCGTCGAACGCACTTCGCCCACCTTGATGA
CCCCCCAACCCTTCAGAGGACCCGCCATGGTGAGCACAAGCAACAGAAGT
TAGGGCGTGATTTGAAGAT
seq4
GGTGACAAGCGGTCTAACGGAGCCTCTACGGGATGGGGATTTTCTGATCA
AACTCTGCCAAGGAGTAGTATAGCACATGAGCTCAGTCGTAGGGAAGCAA
AACAATCACGAGATCCCTCTATATTCTCACCTCCCGAAAGATCTGACCCC
GCCAAGACAGAATATCAGATCCTGAAGATTTATCTCATCCTTAACAGCCA
GGCCGTGGTTCACGTACGGATGACTTTTCGTTAGTGGCGGTATATCGTCC
CTATGTAGGGGAGACGAGACACAAGTATGAGCAGACTTAGCACTTACATC
GGGGACGTTATGGCAAGTGTGCCTGCCCAATGTTCGACTGGCTCCCATGG
GAACTTATAGTTCTTCGGCTACAGACACGGTATATGCCACTCCCTAAAAA
GCTTACAATGTTCAAGCGTAGTCTGTGCAAGGAGAAATGTGATATCATTC
ATGCGAGGCCTCAATTTTTTTTAACAGAGCGGCGGGGCCGCTCGCCGGCC
seq5
AGCTTTGATGGTAGCTGCGAGCCCATCGCCGGTCTAAGGGACTTGATGGA
GGATCAACTCATCCCATTCGGCCTGGCTTGAGTCCTTCAGTCACTCATTC
TCTTGGCCGCGGATAGGATGCACTTATAAACGACCCAAAAGGGCAGGAGT
TTCAGCCCTAGGAGGGTTTCTGGGTTCACTGGCATTAGCACCGACTCTGG
GCTTAATCCAGGTCCCACGGCTGTGCCGAGAGTCCCTTAGCAGGAGTTGG

Prashanth Madi

Prashanth Madi

I'm a programmer & Tech enthusiast. I work for OpenSource Support Team at Microsoft, but this blog, its content & opinions are my own. I blog about tech, gadgets, code, where we're going & we've been.

Read More