/ Bio Informatics

Running cap3

after installing cap3

just take a sequence file and use the following terminal at command prompt

cap3 filename [options]

you can specify constraints and qual

CAP3 takes as input a file of sequence reads in FASTA format. If the names of reads contain a dot ('.'), CAP3 requres that the names of reads sequenced from the same subclone contain the same substring up to the first dot. CAP3 takes two optional files: a file of quality values
in FASTA format and a file of forward-reverse constraints.

The file of quality values must be named "xyz.qual", and the file of forward-reverse constraints must be named "xyz.con", where "xyz" is the name of the sequence file.

my work involved

input

cap3 seq

seq is the file consisting of some sequence of data...

output

6 files

seq.cap.ace
seq.cap.contigs.links
seq.cap.info
seq.cap.contigs
seq.cap.contigs.qual
seq.cap.singlets

seq.cap.ace

AS 1 5

CO Contig1 1422 5 11 U
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTTT
AGTTTTCCTCTGAAGCAAGCACACCTTCCCTTTCCCGTCTGTCTATCCATCCCTGACCCT
GTTGTCTGTCTATCCCTGACCCCGTAGTCTCCTAAGTCGCCCCAGATTTTGTGAACACCC
TCTGGAACTAGAATCTAGTGGGCGGATGGACCATTTACTAGACGGAGGTAGAGGTGGGTG
GATGCGAACGACAGGGTGCATAGTCAGCCCGGTTTTAAGGGCAGGTCACTTGGTAGGTCA
GCAGGCGGGTCAGTGGGCGGGTGCCTGCAGCATTTATGAACTTATTTGGCCCAGCAAACA
TTTTGAGTGTCAGGCCGTGCCTACCCAAGGTGAGGGTAAGGAGCAAAATCAGCCCAGCCC
AGAGCACTGGGTGGCTACACAGAGCCGACCTCTAATGTGCGCTCCGGGTCGGGATGGCAC
TCAGCTCGCCTTTAGGGAGTGATGATCTGGATGCCTGGCTTGGAGGTGACAGAGCCTGCC
CTTATGAGACAATTAAGAGACTGACTAAGCACCCGGCAGGAGGCCACGAGAATCCCCATG
TGAGAAAGAAGAGCATAAACAGGAAACACATTTAATAATTAAACAAAGATAACTCCCTCG
TGTGCGCGCACCGGGCCAGCCCCTATAGAAACATCTGAGGAGTCACTTCCTCCCATGACT
CTCGCCCGCCCGGCCGGCTGGAGTCGGCTCCTGGCAAGCTTCAGGCACCTCAGTTGTCCT
GAATACACACAGCACCCTTTCCTTACTGAAGCCCCTGAGAGCCTCCAGTTCTCCCTCCTT

BQ
10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 1$
20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 2$
20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 2$
20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 2$
20 20 20 20 20 20 20 5 5 5 20 2

AF R3 U 1
AF R1 U 44
AF R2 U 1
AF R4 C 478
AF R6 C 571
BS 1 248 R2
BS 249 250 R3
BS 251 849 R2
BS 850 850 R3
BS 851 974 R2
BS 975 1155 R4
BS 1156 1157 R6
BS 1158 1159 R4
BS 1160 1168 R6
BS 1169 1242 R4
BS 1243 1422 R6


seq.cap.contigs.qual

Contig1
10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10
10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10
10 10 10 10 10 10 10 10 10 10 10 10 10 10 20 20 20 20 20 20
20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20
20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20
20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20

a clear documentation is present about pace at the link below

http://icb.med.cornell.edu/crt/CAP3/example_usage.xml

Prashanth Madi

Prashanth Madi

I'm a programmer & Tech enthusiast. I work for OpenSource Support Team at Microsoft, but this blog, its content & opinions are my own. I blog about tech, gadgets, code, where we're going & we've been.

Read More